Togaviridae

Single-stranded, plus-sense RNA genome

Alphavirus

e.g., Sindbis (SIN), Sindbis-like AR86 (AR8) and Girdwood (GIR) viruses from South Africa, Sindbis-like YN87448 (YN8) virus from China, Ocklebo (OCK), Whataroa, Babanki, Kyzylagach, Xinjiang-160 (XJ1), Aura (AUR), eastern equine encephalitis (EEE), western equine encephalitis (WEE), Venezuelan equine encephalitis (VEE), Highland J (HJ), Buggy Creek, Fort Morgan, Semliki Forest (SFV), Middelburg (MID), Ndumu, Bebaru, Una, Mayaro, chickungunya, o'nyong nyong (ONN, Gulu strain), o'nyong nyong-like Igbo Ora (IGB), o'nyong nyong-like SG650 (SG6), Ross River (RRV), Sagiyama (SAG), Getah, Barma Forest (BFV), salmon pancreatic disease (SPD), rainbow trout sleeping disease (SDV) viruses.

Rubivirus

rubella virus

Conserved 3' 19 nt sequence of genomic RNA

Probably recognized for initiating synthesis of viral minus-strand RNA [Ou, et al., 1981; Levis, et al., 1986; Kuhn, et al., 1990]
Plus-strand sequence is shown

                         -40       -30        -20         -10         (Sindbis virus coordinates)
                     :    |    :    |    :     |    :      |    :      
Sindbis          CUUUUAUUAUUUCUUUUAUUAAUCAAC AAAAUUUUG  UUUUUAACAUUU  C poly-A    J02363
AR86             U-------------------------- ---------  ------------  -           U38305
Girdwood         U-------------------------- ---------  ------------  N           U38304
YN87448          U-------------------------- ---------  ------------  -           AF103734
Ockelbo          U-------------------------- ---------  ------------  -           M69205
Whataroa         U-A-A---U--CU------A-UC---- ---------  ------------  -           AF023292
Babanki          U---AU-AU--CU--------------A---------  ------------  -           AF023290
Xinjiang-160     -C---UA-UA---------C---U---C---------  ------------  -           AF103728
Kyzylagach       UC---UA-UA---------C---U---C---------  -------U----  -           AF023291
Aura             AA-C-U--G---U-C--U-AUUAUUU- ---------  -------U----  -           AF126284 S78478

EEE              AAAA-CA----AA----UC-UU-AUGUUUUU------  -------U----  -           X63135 X67111
WEE              UAAA-UC-U--AUAA--U--CU-UUGUUUUU------  -------A----  -           AF214040 AF143811
Highlands J      AC-A----U--CU---CU---U-UUU-UUUU------  -------A----  -           AF023289

Buggy Creek      U---CU------UA----G-CUAUU-GAUU-G-----  -------U----  -           AF023287
Fort Morgan      U-A-CC------UA----G-CUA-U-GAUU-G-----  -------U----  -           AF023288

VEE TRD          A-------U--------C--UUC-G-AUCGG------  -------U----  -           J04332
VEE Everglades   U-A--U-AU--------C--UUC---AUUGG------  -------U----  -           AF023293
VEE Ag80-663     AGA--U--U---U----UA--UA-C-AUUGG------  -------U----  -           AF023299
VEE Pixuna       U--A--A-U--CUC-GCCAAU--U-GAUUGG------  -------U----  -           AF023294
VEE Cabassou     -CA-----U-A-U--C-U-ACCAAC-AUUGG------  -------U----  -           AF023300
VEE 78V-3531     AAAA-U--UA--UGA--U-CCGAUU-AUUGG------  -------U----  -           AF023298
VEE Mucambo      AAAA-U--UA--U-C--U-ACCAAU-AUUGG------  -------U----  -           AF023295
VEE 71D-1252     AACAAU--UA--U-C--U-ACCAAC-AUUGG------  -------U----  -           AF023297
VEE Tonate       ACAAAU--U-A-U--C-U--CCAAU-AUUGG------  -------U----  -           AF023296

Mayaro           A-AGGGCACC-A--AACCA--GAAGUAAUUC------  -------U----  -           AF023285

Chikungunya      UC-CCGAACCCA-AGGG-CGU-GG-GAUGUU------  -------U----  -           AF023283
ONN (Gulu)       AA--CUCCGACG-AGGG-CGU-GG-GAAGUU------  -------U----  -           M20303 M33999
ONN (Igbo Ora)   UC-CCGAACCCG-AGGG-CGU-GG-GAAGUU------  -------U---   -           AF079457
ONN (SG650)      UC-CCGAACCCG-AGGG-CGU-GG-GAAGUU------  -------U----  -           AF079456

Middelburg       GGAAAUAAUA-CGCGACGA-UGG-U-GUCGC-A--G-   ------U---  C-           AF023284
Ndumu            UAAAAU--UG--U--A-U--UUGAUU-G-UC-A--G-  -------U---- C-           AF023281
Bebaru           AAAAAC--UAA--AGAA--AU-AUUGGAC--CA--G-  -------U---- C-           AF023282
Semliki Forest   GACGA--A---GGA---U-AUU-U-UUUUGC-A--G-  -------U---- C-           X04129
Una              GCAGAU-A---GA--AA--AU-AUUCGAUUG-A--G-  -------U---- C-           AF023280

SPD              A-CCG--CCCACAGGGAG-AGGAUG-GUC-UC-A---  G------A----U -AAUAC      AJ012631
SDV              A-CCG--CCCACAGGGAG-AGGAUG-GUC-UC-A---  G----U-A-A--UU-AAU        AJ238578

Ross River       ACCCC--A-CAC-GGGG-CGU-GGCGU CU----- -UU-------U----UA-           J02337
Sagiyama         ACCCC-GACCA--GGGG-CGU-GGCGU CU----- -UU-------U----UA-           AF023301
Getah            ACCCC-GACCAC-GGGG-CGU-GGCGU CU----- -UU-------U----UA-           AF023279
Barmah Forest    ACCCC-GA-CAC-GGGG-CGU-GGCGU CU----- -UU-------U----UA-           U73745
                     :    |    :    |    :     |    :      |    :      
                         -40       -30        -20         -10         (Sindbis virus coordinates)

Conserved promoter

Recognized for initiating synthesis of viral subgenomic mRNA [Ou, et al., 1982; Levis, et al., 1990; Raju and Huang, 1991]
The sequence from -19 to +5 (relative to the initiation site of the mRNA) is sufficient for directing subgenomic mRNA synthesis. It is about 3-6 fold less active than the sequence from -40 to +14.
Minus-strand sequence is shown

                                                                |--> subgenomic mRNA
             -50       -40       -30       -20       -10       +1         +10
         :    |    :    |    :    |    :    |    :    |    :    |   :      |
nsP4 SerLysArgAlaPheGlnAlaIleArgGlyGluIleLysHisLeuTyrGlyGlyProLystrm
SIN  UCGUUUUCUCGUAAGGUUCGGUAGUCUCCCCUUUAUUUCGUAGAGAUGCCACCAGGAUUUAUCA  GUCGUAUCA    SINCG      J02363
A86  --------------A-------------------------------------------------  ---------    ACU38305   U38305
Gir  --------------A-------------------------------------------------  --------G    ACU38304   U38304
YN8  --------------A----------------------C--------------------------  ---------    AF103734   AF103734
OCK  ------G----------------U-----A----------------------------------  ---------    SINOCK82   M69205
XJ1  -------UAA-C--A--------A-----U-----------U----------------------  --------G    AF103728   AF103728
AUR  ---C-A-U------AU----UG-UG-G---UCGGG--CU--G---------------------U  -C-AC---G    AF126284   AF126284 S78478
SFV  CU--AA-UC--C--AU-CUUUA-C-----UGGAC-A-AU--G--------G----------A-C  ACGCA--U-    ALSFV42S   X04129
MBV  -UAA-AGUGUUA----C-GUAG-U-----UGGGC-A-AAC-G--------G-------------  ACGCAC-U-    MBVCP      J02246
BFV  -U-AAC-UCA-G---UC-UU---U------U--GG--AU-------------------------  ACG-C-AUC    BFU73745   U73745
RRV  ---GAC-UCUUA--AU--UUCG-CG-A--UGGG--GCAU--G--------G------------U  ACGUCUCUG    RRVNBCG    J02337
SAG  -UAAAC-UCA-A--AUCCUUU--U-----AGGG--G-AU-----C-----G------------U  ACGUCC-A-    AB032553   AB032553
ONN  ------CU-UUG--AU-CUUUG-U------GGGC-GCAUUGGA-C-----G--U---------C  A-GCGUGAU    ONNCG      M20303 M33999
IGB  --A---CU-UUG--AU--UUUG-U------GGGC-GCAUUGGA-C-----G--U---------C  A-GCGUAAU    AF079457   AF079457
SG6  ------CU-UUG--AU--UUUG-U------GGGC-GCAUUGGA-C--------U---------C  A-GCGUGAU    AF079456   AF079456
WEE  ---CAA-UCUUG---U-CUC---U------U-GGG--AGUGG--------GA-U---------C  ACU-C----    AF214040   AF214040 AF143811
EEE  AGUCAA--GUUG--AU--GU---U-----AG-GGGG-AUUGG--------GA-U---------C  AA-ACG-A-    EEEVIRNA   X63135 X67111
VEE  --ACAA-U-A-----UCGAU-G-C-------GGGGA-AUUG---------GAUU---C---C-U  -AU-CUGU-    EEVNSPENV  J04332
SPD  CU-AAC---A-C-U--AC-C-CGCG-------CAUGCAUAGG-------AGAUU---A----A-AA-A----GU-    SPA012631  AJ012631
SDV  CUAGAC---A-C-U-AAC-C-CGCG-------CAUGCAUAGG-------GGAUU---A----A-AA-A----GU-    SDI238578  AJ238578
                                             |- minimal promoter -|         
                        |------------------- full promoter ---------------------|

Conserved RNA structure at the 5' end of the genomic RNA

Probably recognized (on the minus-strand) for initiating synthesis of viral plus-strand RNA, and for translation regulation [Ou, et al., 1983; Levis, et al., 1986; Niesters and Strauss, 1990a].

Conserved double stem-loop structure near the 5' end of genomic RNA

Function of the conserved sequences is unknown [Ou, et al., 1983; Niesters and Strauss, 1990b].
Plus-strand sequence is shown

          stem 1  loop 1 stem 1       stem 2 loop 2  stem 2
         ------->       <--------    ------->      <--------
SIN  CACAGCAGGUCACUCCAAAUGACCAUGCUAAUGCCAGAGCAUUUUCGCAUCUGGCCAGUAAA 3'  SINCG      J02363
SFV  --UU---------A--------------A--------------------C-----U-CC---     ALSFV42S   X04129
HJ       ---------AG-C-----------------------G---------G----T-CA--G     HJV01      K00700
RRV  -------------A--U-----------------------U----------------CA--G     RRVNBCG    M20162
EEE  -CAC---------CGAC-----------------U-----G--------------U-CA---     EEEVIRNA   X63135 X67111
ONN  --A----------G--------------A--C--U-----------------A--A-UA---     ONNCG      M20303
VEE  -CA-----------GAU-----------------------G------------G-UUCA---     EEVCOMGEN  L04653