Rhabdoviridae

Single-stranded, minus-sense RNA genome

Sequences shown here are those of the genomic minus-strand RNA

Vesiculovirus

e.g., vesicular stomatitis Indiana virus (VSIV), vesicular stomatitis New Jersey virus

Lyssavirus

e.g., rabies virus, European bat virus, Mokola virus, Duvenhage virus

Novirhabdovirus

e.g., Salmon infectious hematopoietic necrosis virus (IHNV), Viral haemorrhagic septicaemia virus (VHSV), hirame rahbdovirus, Snakehead rhabdovirus (SHRV), panaeid shrimp rhabdovirus, spring viremia of carp virus.

Conserved terminal sequences of genomic RNAs

A. Conserved terminal sequences are invert repeats, can potentially form panhandle structures, and are recognized for replication, transcription or packaging [Wertz, et al., 1994]:(IHNV strain WRAC; VHSV strain Fil3)

VSIV    5' ACGAAGACCACAAAACCAGAUAAAAAAUAAAAA_____    VSVCG    J02428
           |||||||| |  ||||||     |  || ||||     )
        3' UGCUUCUGUUUGUUUGGUAAUAAUAGUAAUUUU¯¯¯¯¯

Rabies  5' ACGCUUAACAAAUAAACAACAAAAAUGAGAAAA_____    RAVCGA   M31046
           ||||||||||| :| |  | | ||| :| | |      )
        3' UGCGAAUUGUUGGUCUAGUUUCUUUUUUGUCUG¯¯¯¯¯

IHNV    5' GUAUAAAAAAAGUAACAGAAGGGUUCUCAAAAGGCAGUUAAAAAAGGUUUUUAAUAACGG___  IHNCG    L40883
           |||||| |||||||||   |  :  |||| ||||  :: |  | ||:      | || ||   )
        3' CAUAUUCUUUUCAUUGAACUGAUUCGAGUCUUCCUGUGUUCCUGUCUUUUUUCUUUUUCC¯¯¯

VHSV    5' GUAUAGAAAAUAAUACAUACCACAAUCGAAAGAAUGAAGAACAAGAAAUCCGAGGAGGGA___  VHS18263 Y18263
           |||| : |||  ||    |      | : |||    | ||| ||: ||   :| |  : |   )
        3' CAUAGUAUUUUCUACUACUCAAUACAAUGUUCCCUGUCCUUUUUUCUUUUAUUGCCGUGU¯¯¯

SHRV    5' GUAUAGAAAAAGAUGAUAUAUUUUUUUCUAGGACAAAUCCAGUUUUUUUCUGUCUGCUGU___  AF147498 AF147498
           |||| :|||||||||||    :||     |:|| |      :         |   ||      )
        3' CAUAGUUUUUUCUACUACUAUGAACCUUCUUCUCUACUUCCUUUUCUUUUUCUACCGUGC¯¯¯

Conservation of terminal sequences within a genus, e.g., Novirhabdovirus:

IHNV  GUAUAAAAAAAGUAACAG...   ...GUCAAGUUACUUUUCUUAUAC 3' end vRNA   IHNCG    L40883
VHSV  -----G----UAAU---U...   ...ACUC-UCAU-----A-G----               VHS18263 Y18263
SHRV  -----G------AUGAUA...   ...UAUC-UCAU-----U-G----               AF147498 AF147498

Some similarity (conservation?) of the termini of the genomic RNA of Sendai virus (Paramyxoviridae), VSIV (Rhabdoviridae) and Marburg virus (Filoviridae)

        5' end                               3' end
Sendai  ACC AGACAAGAGUUUAAGA.....UUUUUCUCUUGUUU GGU    PAFZSTR   M30202
VSV     --GA----C-C-AAACC---.....-GG--UGU----C-UC--    VSVCG     J02428
MBG   GG--AC-C-A--A-AGAUG-AG.....-C--GU-U----G-GUC-    MVREPCYC  Z12132

Conserved sequences encompassing mRNA start and end

The conserved sequences are recognized for initiation and termination of mRNA transcription. See: Schnell, et al., 1996; Barr, et al., 1997; Barr, et al., 1997.

VSIV (VSVCG, J02428), using NS start and N end as prototypes:

                    Leader or  mRNA                             mRNA
                   intergenic  start           Gene              end
                     sequence  |-->                             -->|
           3' end...UCUUUGAAA  -----AU----U...   N    ...AUACUUUUUUU
                           GA  UUGUCUAUAGUA...   NS   ...-----------
                           C-  -----------G...   M    ...-----------
                           --  ------C---CU...   G    ...-----------
                           --  -----GU-----...   L    ...-----------GAAACU... 5' end vRNA

Rabies virus (RAVCGA, M31046) [Tordo, et al., 1986; Tordo, et al., 1988], using M1 start and N end as prototypes:

                    Leader or  mRNA                             mRNA
                   intergenic  start           Gene              end
                     sequence  |-->                             -->|
        3' end...UUCGUUUUUAC-  ---------U-U...   N  ...UAGUACUUUUUUU
                           GA  UUGUGGGGAGGA...   M1 ...-U-----------
                        GUCCG  ------U--CU-...   M2 ...CUAC---------
                        GAUA-  ----A-----UU...   G  ...C--CU--------
     GUAAUCUAGUCUUCUUGUUGACCG  -----AA---UU...   L  ...---AA--------GUUCUA... 5' end vRNA

 

Novirhabdoviruses, using the putative intergenic dinucleotide and start signal of P, and termination signal of N as prototypes:

IHNV (IHNCG, L40883)

         Leader or  mRNA                                          mRNA
        intergenic  start                    Gene                  end
          sequence  |-->                                          -->|
UCUUUUUUCUUUUUCC--  -----AG---AC-UUG-ACU...   N    ...GGAUCUAUCUUUUUUU
                AC  CGUGAUAUCACGAAAAGUUG... P (M1) ...--U---G---------
                --  ----CGU----AU-GCAAG-... M (M2) ...--U---G---------
                --  -----A-A-------CUC--...   G    ...U-G---G---------
                G-  ----UA-A-----CGUU--U...   NV   ...--G-------------
                --  -----A-A----UUUUU---...   L    ...--------G-------ACCGAGG... 5' end vRNA

VHSV (VHS18263, Y18263)

         Leader or  mRNA                                          mRNA
        intergenic  start                    Gene                  end
          sequence  |-->                                          -->|
CCUUUUUUCUUUUAUU--  ----UAUUC--CG--UUUC-...   N    ...GUGUCUAUCUUUUUUU
                GC  CGUGCUAAUAUUCUUAAAGA...   P    ...----------------
                --  ------G-C-AGU-CGUGUG...   M    ...UAA-------------
                A-  ----UA--C-CAUG-GUU-U...   G    ...CCA-------------
                A-  ----GA----C-A--UCUUU...   NV   ...-G--------------
                A-  --A-AA--C-ACAAAC-UU-...   L    ...UAA----A--------GAUACUG... 5' end vRNA

SHRV (AF147498, AF147498)

         Leader or  mRNA                                          mRNA
        intergenic  start                    Gene                  end
          sequence  |-->                                          -->|
UUCCUUUUCUUUUUCUA-  -----AU---A--UU-C-CA...   N    ...UCAUCUAUCUUUUUUU
                GC  CGUGCUCUCA CGAAUUUAG...   P    ...GU----G---------
                --  ---------- ---U-----...   M    ...CUU---G---------
                --  ---------- ---------...   G    ...UGC---G---------U
                --  ----A-A--- --UG--AGU...   NV   ...AU--------------
                --  -----AU-ACACGAAUUGCU...   L    ...--G---G---------GACCUAA... 5' end vRNA

Comparison of Novirhabdovirus transcription signals, e.g., P (M1) gene:

                    mRNA                                          mRNA
        intergenic  start                   Gene                   end
          sequence  |-->                                          -->|
IHNV            AC  CGUGAUAUCACGAAAAGUU...  P (M1) ...GGUUCUGUCUUUUUUU
VHSV            G-  ----C--AU-UUCUU-AAG...    P    ...-UG---A---------
SHRV            G-  ----C-C-------UUUAG...    P    ...-UA-------------