Picornaviridae

Single-stranded, plus-sense RNA genome

Conserved 5' and 3' sequences

Enterovirus

e.g. poliovirus (Polio) 1, 2 and 3 [e.g., Racaniello and Baltimore, 1981]; coxsackieviruses (Cox) [Iizuka, et al., 1987; Klump, et al., 1990; Lindberg, et al., 1987]; swine vesicular disease virus (SVDV) [Seechurn, et al., 1990].

Rhinovirus

e.g., human rhinovirus (HRV) 1A, and over 100 other human rhinoviruses

5' terminus, part of conserved cloverleaf structure essential for replication [Xiang, et al., 1995], well conserved among enteroviruses and rhinoviruses [Rivera, et al., 1988]

                 stem     stem             stem  stem     stem stem     stem       stem    stem   stem
                   A        B               B      C       C     D        D         D       D      A
                *-----> *------->       <-------* *->     <-**--  --->   *-->      <--*   <-----*<-----* 
Polio 2  5'VpG UUAAAACAGCUCUGGGGUUGUUCCCACCCCAGAG GCCCACGUGGCGGCCAGUACACUGGUAUUGCGGUACCUUUGUACGCCUGUUUUAUACUCCCUUCCC   POL2LAN  M12197
Polio 3        ---------------------------------- --------------U-------------CA--------------------------------C---   POL3L37  K01392
Polio 1        ---------------------A------------ --------------U-----U-C--------------C----------------------------   POLIO1B  V01149
Cox B1         ----------CUGU--------------- -C-- -----U ---GC--U--C--U-------CA------------G-----------C-UC----C---   CXA1G    M16560
Cox B5         ----------CUGU-------A------- -C--G------ ---GC--U--C--U------CC-------------G-------------UC---CCU--   CXB5CGA  X67706
Cox B4         ----------CUGU-------A------- -C--G-----A ---GC--U--C-----------C------------G-------------AC---CC---   CXB4S    D00149
SVDV           ----------CUGU--------------- -C--G------ ---GC--U-------------CA------------G---------G-CUUA----C---   SVDG     D00435
HRV1b          -------U-GGUGU-------------U- -C-CCA----A ---GU- UU----U---U----C-----A-----------AU---CCCU-C-U-CC-AU   HRVACG   D00239
HRV2           -------U-GAUCCA-------------UGGAUU U-----AG--A-  UG----U---U----A-----A-----------A-------CUC--U-C---   PIHRV2G  X02316
HRV89          -------U-GGAGU-------------U --CUCCA----U-C--U-  UU----U---U----A-----A-----------A-----UCC-A--------   HRV89    M16248
HRV14          ----------GGAU----  A-------  -UUCGA----UUG--U-  U-----U------C-AU --------------------CUCC-CAA-CA---   HRV      K02121

3' terminus

Polio 2      ...UACUGUUGUAGGGGUAAAUUUUUCUUUAAUUCGG AGG   poly-A   POL2LAN   M12197
Polio 3      ...-------------------------------------    poly-A   POL3L37   K01392
Polio 1      ...-------------------------------------    poly-A   POLIO1B   V01149
Cox B1       ...CGG--CA--G----------C-C-GC  ------UGC-   poly-A   CXA1G     M16560
Cox B5       ...CGG--CG-------------A-C-GC  ------UGC-GG poly-A   CXB5CGA   X67706
Cox B4       ...CGG--CA-------------C-C-GC  G-----UGC-G  poly-A   CXB4S     D00149
SVDV         ...A-G--CG-------------C-C-G-  ------UGC-G  poly-A   SVDG      D00435

3' sequence of rhinoviruses resemble each other, but do not resemble that of the enteroviruses.

Aphthovirus

e.g., the 7 foot-and-mouth disease viruses (FMDV):

5' terminus

FMDV A 61  VPg UUGAAAGGGGGCGCUAGGGUUUCACCCCUAGCAUGCCACUGCAGUCCCUGCGAUACACUC... 3'    APHA615E   M10496
FMDV ASIA1 VPg ----------------------------C--UGCCA-CGGCAGUC--UGCGUC-CACUC-...       APHOV15E   M10506
FMDV C 997 VPg ------------------------------AGUGU-A--GA-----------U-G-----...       APHC975E   M10504
FMDV O V1  VPg ------------A--------------------C----AC-ACAGU--CUGCG-UGCACU...       APHOV15E   M10502
FMDV SAT1  VPg ------------A-------C-UG---AGUU-GCCGU-AC-ACCGU--CUGCGAUUCA-U...       APHSAT15E  M10507
FMDV SAT2  VPg ------------A-------C-UG---UAGUGUC--GUAACG-CCGU-CC--G-UG-AA-...       APHSAT25E  M10508
FMDV SAT3  VPg ------------A-------C-AG---UAGUGUC--GUAACG-CCGU-CC--G-UG-AA-...       APHSAT35E  M10509

Note some similarity to enteroviruses:

Polio 2   VPg UUAAAA  CAGCUCUGGGGUUGUUCCCA... 3'
FMDV A61  VPg --G---GGGG--G--A-----UCA---C...

3' terminus

FMDV A61     ...GAAAAGCUCGAAAGAGCUUUUCCCGCUUCCUCAAUUC poly-A    APHA613E  K01351
FMDV SAT1    ...------GC------G----------------U---C- poly-A    APHSAT1   K01349
FMDV O1C     ...-----U-C------ ----------------U---C  poly-A    APHO1C3U   D10148
FMDV C3R     ...-------C-----AG---------------- -U-C- poly-A    APHC3R3U   D10150

Cardiovirus

e.g., encephalomyocarditis virus (EMC), Maus-Elberfeld virus (ME), Theiler's murine encephalomyelitis virus.

5' terminus (Note some similarity to FMDV):

EMC pv21  VPg UUGAAAGCCGGGGGUGGGAGAUCCGGAUUGCCAGUCUACU... 3'   EMCGAA   X74312
EMC-D     VPg ----------------------------------------...      EMCDCG   M22458
FMDV A61  VPg -------GG--C-C-A--GUU--ACCCC...

3' terminus:

EMC pv21     ...GCAAGAUAGUCUAGAGUAGUAAAAUAAAUAGUAUAAG poly-A    EMCGAA    X74312
EMC-D        ...---------A----------------------U-U-- poly-A    EMCDCG    M22458
ME           ...--------AA---------------------UUAG-- poly-A    MEV3E     K01355

Hepatovirus

See Cohen, et al., 1987

e.g., Hepatitis A virus, simian hepatitis A virus

5' terminus

HM-175    VPg UUCAAGAGGGGUCUCCGGGAAUUUCCG...     HPA    M14707
LA        VPg ---------------------------...     HPAA   M16632
MBB       VPg -------------------G-------...     HPACG  M20273

3' terminus

HM-175       ...UUUGUUUAUUUCUUUUAUCAGUAAAU poly-A  HPA    M14707
LA           ...--------------------------         HPAA   M16632
MBB          ...-----C-------G----U-------         HPACG  M20273