Paramyxoviridae

Single-stranded, minus-sense RNA genome

Paramyxovirinae

Respirovirus (Paramyxovirus)

e.g., human parainfluenza virus 1 (HPIV1) and 3 (HPIV3), Sendai virus

Morbillivirus

e.g., measles virus, canine distemper virus, dolphin distemper virus, phocine distemper virus, peste-des-petits-ruminants virus, rinderpest virus.

Henipahvirus

e.g., Hendra and Nipah viruses [Wang et al. 2000].

Rubulavirus

e.g., mumps virus, human parainfluenza virus 2, 4a and 4b

Avulavirus

e.g., Newcastle disease virus (NDV = APMV-1), avian paramyxovirus 2 through 9 (APMV-2 to APMV-9)

"TPMV-like viruses"

e.g., Tupaia virus

Pneumovirinae

Pneumovirus

e.g., human respiratory syncytial virus (HRSV).

Metapneumovirus

e.g., turkey rhonotracheitis virus (TRTV).

Conserved terminal sequences of genomic RNAs

(See: Galinski and Wechsler, 1991)

Recognized for replication, transcription or packaging. Terminal 5' 145 nt and 3' 119 nt of Sendai [Park, et al., 1991], and 5' 91 nt and 3' 97 nt of HPIV3 [De and Banerjee, 1993; Dimock and Collins, 1993] are sufficient for replication, initiation of mRNA transcription, and encapsidation.

          5' end            genomic RNA           3' end
Sendai    ACCAGACAAGAG UUUAAGAG.....UGUUUUUUCUCUUGUUUGGU   SNDZSTR   M30202
HPIV3     ----A--------   ----A.....A----C--------------   PAHPIV3   X03967    PIFHNFD   M21649
Measles   ---------AGCUGGG--U--.....CU-ACCCAACU---------   MEANP     K01711
Hendra    ---GA-----G-  -A-----.....CA-A---C-C------C---   AF017149  AF017149

5' and 3' ends are invert repeats that can potentially form panhandle structures

Paramyxovirus: Sendai

    5' end ACCAGACAAGAGUUUAAGAGAUAUGUAUCCU_____
           ||||:|||||||   ||: :                )
    3' end UGGUUUGUUCUCUUUUUUGUACAUACCCUAU¯¯¯¯¯    SNDZSTR   M30202

Morbillivirus: Measles

    5' end ACCAGACAAAGCUGGGAAUAGAAACUUCGUA_____
           ||||:|||||| |||| |  || | |||: |     )
    3' end UGGUUUGUUUCAACCCAUUCCUAUCAAGUUU¯¯¯¯¯    MEANP     K01711

Morbillivirus: Hendra virus

    5' end ACCGAACAAGGGUAAAGAGAGAUCGUUAUUA_____
           |||||||||||| ||| |  |||   | |||     )
    3' end UGGCUUGUUCCCCUUUAUACCUAUGCACAAU¯¯¯¯¯    AF017149  AF017149

Pneumovirus: RSV

    5' end ACGAGAAAAAAAGUGU  CAAAAACUAAUAU_____
           ||| ||||||| |:||   | |||||  :||     )
    3' end UGCGCUUUUUUACGCAUGUUGUUUGAACGUA¯¯¯¯¯    RSHSEQ    M74568

Some similarity (conservation?) of the termini of the genomic RNA among the Mononegavirales: Sendai virus (Paramyxoviridae), VSV (Rhabdoviridae) and Marburg virus (Filoviridae)

        5' end                               3' end
Sendai  ACC AGACAAGAGUUUAAGA.....UUUUUCUCUUGUUU GGU    PAFZSTR   M30202
VSV     --GA----C-C-AAACC---.....-GG--UGU----C-UC--    VSVCG     J02428
MBG   GG--AC-C-A--A-AGAUG-AG.....-C--GU-U----G-GUC-    MVREPCYC  Z12132

Conserved mRNA start, end, and intergenic sequences

Recognized for initiation and termination of mRNA transcription (e.g., RSV: Kuo, et al., 1996a; Kuo, et al., 1996b):

                                mRNA                               mRNA
                    intergenic  start           Gene                end
                      sequence  |-->                               -->|
HPIV3           3'     ...GAA   UCCUAAUUUCU...   NP     ...UUUAUUCUUUUU
(Paramyxovirus)           ---   -----------...   P+C    ...------------
PAHPIV3   X03967          ---   -----------...   M      ...C-AU-AG-----
PIF3NPPC  M13886          ---   ----G------...   F      ...--A--AU-----
PIF3MF    M13888          ---   ----C-----A...   HN     ...-----AU-----
PIFHNFD   M21649          ---   ----CG----G...   L      ...C-AUC-G-----... 5' genomic RNA

                               mRNA                                 mRNA
                    intergenic start            Gene                end
                       sequence |-->                               -->|
Measles virus   3'     ...GAA   UCCUAAGUUCU...    N      ...CAAUAUUUUUU
(Morbillivirus)           ---   ----UG--C-A...    P      ...U----------
MEANP   K01711            ---   ----CGU---A...    M      ...UG--U-G----
                          ---   ---CGGU-C--...    F      ...----UAA----
                          ---   ---C-C-----...    H      ...U---UC-----
                          -C-   ---C-G----A...    L      ...U---U-C----... 5' genomic RNA

                                mRNA                               mRNA
                    intergenic  start           Gene                end
                      sequence  |-->                               -->|
Hendra virus    3'     ...GAA   UCCUUGGUUCU...    N     ...AUAAUUCUUUUU
(Morbillivirus)           ---   ----A------...  P/V/C   ...G-----------
AF017149  AF017149        ---   ----CU--C-A...    M     ...------------
                          ---   ----C-----A...    F     ...GA---GU-----
                          ---   ----G-----A...    G     ...U-----------
                          ---   ----G-----A...    L     ...------------... 5' genomic RNA

                                mRNA                               mRNA
                    intergenic  start           Gene                end
                      sequence  |-->                               -->|
Nipah virus     3'     ...GAA   UCCUUGGUUCU...    N     ...GUAAUUCUUUUU
(Morbillivirus)           ---   ----A------...  P/V/C   ...U-----------
AF212302  AF212302        ---   ----CU--C-A...    M     ....              5' genomic RNA

Nipah virus transcription signals are almost identical to those of Hendra virus.

                               mRNA                                mRNA
                     upstream  start            Gene                end
                    sequences  |-->                                -->|
RSV             3'...UUUUUUUA  CCCCGUUUAUUC... NS1/1C ...AUCAAUUAUAUUUU
(Pneumovirus)         G------  -----------U... NS2/1B ...UAUC----A-----
RSHSEQ   M74568      A-C--C--  ----------GU...   NP   ...C--------U----
                     A-------  -----------U...   P    ...------GU-U----
                     C---CCC-  ----------A-...   M    ...U--------U----
                      A-G-G--  -----------A...   SH   ...--------AU----
                      A--G-A-  ---------CGU...   G    ...------G-AU----
                     A---GAG-  -----------G...   F0   ...UAUC-A--------
                     AC----G-  ----------A-... 22K/M2 ...UAUC-A--A-----
                     G--CAAC-  ---U----UAC-...   L    ...UAUC-A--AU----... 5' genomic RNA

Upstream sequences of RSV are non-essential [Kuo, et al., 1996; Bukreyev at al., 2000].

Note similarity of the transcription signals of HPIV3, measles and Hendra viruses

HPIV3           3'     ...GAA   UCCUAAUUUCU...   NP     ...UUUAUUCUUUUU
Measles virus          ...---   ------G----...    N      ...CA--AU-----
Hendra virus           ...---   ----UGG----...    N     ...A-A---------

References

Those that are not available through PubMed, National Library of Medicine, USA.