Flaviviridae

Single-stranded, plus-sense RNA genome

Flavivirus

e.g., yellow fever (YF); dengue (DEN) serotypes 1, 2, 3, and 4; Japanese encephalitis (JE), West Nile (WN), Kunjin, Murray Valley encephalitis (MVE), St. Louis encephalitis; tick-borne encephalitis viruses

Pestivirus

e.g., bovine diarrhea virus (BVDV), border disease virus (BDV), hog cholera virus

Hepacivirus

e.g., hepatitis C virus

Conserved terminal sequences of the genomic RNA

Sequences are plus-sense

Flavivirus

The 5' terminus

Probably recognized as the complement, for initiating synthesis of viral plus-strand RNA.

Strong conservation among the dengue viruses:

       5' end
DEN3   AGUUGUUAGUCUACGUGGACCGACAAGAACAGUUUCGACUCGGAAGCUUG...    DENCME    M93130
DEN4   ------------GU-------------G------C-A-A-----------...    DENSTRA   M14931
DEN1   NNNNNNNNNNNNNN--------CA--------------A-----------...    DENT1SEQ  M87512
DEN2   NNNNNNN-------------------AG----A---UUUGA--G----AA...    DEN2CGA   M29095

and among the tick-borne encephalitis viruses of either European (Hypr, 263, Neudoerfl) or Far Eastern (Powassan, Sofjin) subgroups:

       5' end
HYPRV  AGAUUUUCUUGCGCGUGCGUGCGUUUGCUUCGGACAGCAU   TEU39292   U39292
263    ------------A-----A---------------------   TEU27491   U27491
NEUV   ------------A-----A---------------------   TE27495    U27495
POW    ------------A----U-----GG-----UA-U---UG-   PWARPT     L06436
SOFV   NNNNNNN-----A-----A----------C----U----A   TBEV1      X07755

Considerable divergence between flaviviruses of different serological groups, suggesting that the primary sequence is not recognized per se, but might be recognized as an RNA structure [Khromykh et al., 2001]:

       5' end  
YF     AGUAAAUCCUGUGUGCUAAUUGAGGUGCAUUGGUCUGCAAAUCGAGUUGC...    FLYF17DG X03700
JE     --A-GU-UA-C----UG--C-UCUUG--U-A-UAUC-UUG-GAAGAA-CG...    JEVSAV   D90194
WN     ----GU--GCC----UG-GC---CAAA-U-A-UAG--UUUG-GAG-A-UA...    WNFCG    M12294
DEN3   ---UGU-AG-C-AC-UGG-CC--CAA-A-CA-U-UC-ACUCGGA--C-UG...    DENCME   M93130
HYPRV  --AUUU--U--C-C-UGCG-GCGUU---U-C--A-A---UUAGC--CG-U...    TEU39292 U39292

The 3' terminus

The 3' terminus contains an RNA structure, probably recognized for initiating synthesis of viral minus-strand RNA.

The 3' terminal sequence is strongly conserved among the Dengue viruses,

                                                     3' end
DEN3  ...AGGCACAGAACGCCAGAAAAUGGAAUGGUGCUGUUGAAUCAACAGGUUCU
DEN1  ...--------------------------------------------------
DEN2  ...--------------------------------------------------
DEN4  ...---------G----GC--G-----U-----U------UC-----------

and among the tick-borne encephalitis viruses of either European (Hypr, 263, Neudoerfl) or Far Eastern (Powassan) subgroups:

                                                        3' end
HYPRV ...AGACACAGAUAGUCUGACAAGGAGGUGAUGUGUGACUCGGAAAAACACCCGCU
263   ...----------------------------------------------------- 
NEUV  ...--------G-------------------------------------------- 
POWV  ...--G---------C-----------A--G------------------------- 

More distant conservation among the different serological groups, probably reflecting recognition of an RNA structure instead of the primary sequence [Khromykh et al., 2001]:

                                                           3' end
DEN3  ...AGGCACAGAACGCCAGA AAAUGGA AUGGUG   CUGUUGAAUCA ACAGGUUCU
DEN4  ...---------G---- -CA-G----- U-----   U------UC-- ---------
JE    ...---------G---- --AGU---U-GC-----   G--AG---GA-C-----A---
WN    ...C-------UG---- --C-U-G-UGGC-----     --GCU-GA-C-----A---
HYPRV ...--A------UA-U-U--C--  ---GG--A--UGUGAC-C-G-AA- ---CCCG--

Pestiviruses

The 5' and 3' terminal sequences

Comparison of BVDV type 1, ILLC (cytopathic) and ILLNC (non-cytopathic) strains, BVDV Type 2 Alfort A19 strain, BVDV NADL strain, and border disease virus BD31 strain:

BVDV ILLC        GUAUACGAGAAUUUGCCUAGGACCUCGUUU.....UUGGAAUUGGGAGCACUUUAGCUGCCCCCC    PTU86599   U86599
BVDV ILLNC       ----------------------------A-.....-----U-A----------------------    PTU86600   U86600
BVDV Alfort A19  ---------GU-AGUU-AUUCU-G-AUGCA.....-----C-AA--  U-A---CCUAA-GG---    PTU90951   U90951
BVDV NADL        -------------A-AAA---CA-----A-.....G-----C-A----AG--C-CUAACAG        BVDCG      M31182
BDV  BD31        -A-CUAC-UC--ACU-G-GUACAAAAU-GG.....--UA--C-AC -------------GAGGG     BDU70263   U70263

Conserved repeats in the 3' UTR of mosquito-borne flaviviruses

Repeats consist of 5' RCS2--CS2--CS1 3' [Hahn et al., 1987; Chambers, et al., 1990] for cyclization by base pairing with a complementary sequence at the 5' terminus. Cyclization mediated by CS1 (bold) is essential for replication [Khromykh et al., 2001; Lo et al. 2003], while the other repeats are required to achieve wildtype levels of replication:

DEN4  RCS2  GGACUAGCGGUUAGAGGAGACCCC..65 nt..
      CS2   -------A----------------..13 nt..CAGCAUAUUGACG CUGGGA AAGAC   CS1 3'

DEN2  RCS2  ------------------------..63 nt..
      CS2   -------A----------------..14 nt..------------- ------ -----   CS1 3'

DEN3  RCS2  A------U----------------..61 nt..
      CS2   -------A-----U----------..13 nt..------------- ------ G----   CS1 3'

DEN1  RCS2  A------U----------------..60 nt..
      CS2   -------A----------------..15 nt..------------- ------ G----   CS1 3'

JE    RCS2  -------A----------------..54 nt..
      CS2   -------A----------------..14 nt..------------AC------AU----   CS1 3'

WN    RCS2  -------A----------------..50 nt..
      CS2   -------A----------------..22 nt..------------AC------ U----   CS1 3'

MVE   RCS2  -------A---------------U..50 nt..
      CS2   -------A----------------..21 nt..------------AC------A-----   CS1 3'  MVEAAA    M35172

YF    CS2   --U----A---------------U..18 nt..G-C----------C-A---- -----   CS1 3'  FLYF17DG  X03700