Filoviridae

Single-stranded, minus-sense RNA genome

Sequences shown here are those of the genomic minus-strand RNA

Filovirus

e.g. , Marburg virus (MBG), Ebola virus (EBO).

Conserved terminal sequences of genomic RNAs

[e.g., Kiley, et al., 1986]

                  5' end                                        3' end
Marburg (Musoke)   GGACACACAAAAAAGAUGAAGAA...AUCAUCUCUUGUUUUUGUGUGUCU    MVREPCYC   Z12132
Ebola (Mayinga)   U----------------A---AU-...--UC-UCU--C------------CG   AF086833   AF086833

5' and 3' ends are invert repeats, that potentially form panhandle structures, probably recognized for replication, transcription or packaging.

e.g., Marburg virus:

  5' end GGACACACA AAAAA     GAUGAAGAAUGUUUUGUGUUACUUAUAUCAAAGCU_____    MVREPCYC   Z12132
           | ||||| |||||     ||||| ||   ||||||||  | ||||   ||:       )
    3' end UCUGUGUGUUUUUGUUCUCUACUACU   AAAACACAUAGUAUAUUUAUUUCU¯¯¯¯¯

Some similarity (conservation?) of the termini of the genomic RNA of Sendai virus (Paramyxoviridae), VSV (Rhabdoviridae) and Marburg virus (Filoviridae)

        5' end                               3' end
Sendai  ACC AGACAAGAGUUUAAGA.....UUUUUCUCUUGUUU GGU    PAFZSTR   M30202
VSV     --GA----C-C-AAACC---.....-GG--UGU----C-UC--    VSVCG     J02428
MBG   GG--AC-C-A--A-AGAUG-AG.....-C--GU-U----G-GUC-    MVREPCYC  Z12132

Conserved transcription start and termination signals

e.g., Marburg virus

              mRNA                                  mRNA
    upstream  start             Gene                 end
    sequence  |-->                                  -->|
    3'...UAU  UUCUUCUUAUAAUU     NP     ACGGUUAAUUCUUUUU
      ...-U-  AG------------    VP35    -AAA------------
      ...-GA  -A------G-----    VP40    CUUUA-C---------
      ...G--  -A------G-----     GP     GGAAA-----------
      ...CUC  AG------G-----    VP30    U-UUG-----------
      ...-UG  -A------G-----    VP24    CUAAC-----------
      ...AG-  -A--A-C-------     L      --AU------------...5'

Transcription signals are conserved between Marburg and Ebola viruses

              mRNA                     mRNA
              start                     end
              |-->                     -->|
        MBG   UACUUCUUGUAAUU    UAAUUCUUUUU 5'
        EBO   ----A---C-----    -----------