Caliciviridae

single-stranded, positive-sense RNA genome

Sequences shown here are those of the genomic plus-strand RNA

Norovirus (formerly Norwalk-like viruses)

Most isolates are human caliciviruses (HuCV):

Genogroup I: HuCV/Norwalk (NV), HuCV/Desert Shield, HuCV/Chiba, HuCV/Southhampton, bovine enteric calicivirus (BoCV, Jena), bovine Newbury 2 agent

Genogroup II: HuCV/Snow Mountain, HuCV/Hawaii, HuCV/Mexico, HuCV/Lorsdale, HuCV/Grimsby, HuCV/Toronto, HuCV/Melksham, swine enteric caliciviruses

Sapovirus (formerly Sapporo-like viruses) (Genogroup III)

Most isolates are human caliciviruses (HuCV):

e.g., HuCV/Sapporo, HuCV/Parkville, HuCV/Manchester, HuCV/London, porcine enteric (PoCV) caliciviruses

Vesivirus

e.g., swine vesicular exanthema (SVEV), feline (FCV), San Miguel sea lion (SMSV), pygmy primate (PCV, Pan-1), reptile, bovine, skunk calicicviruses

Lagovirus

e.g., rabbit hemorrhagic disease (RHDV), European brown hare syndrome (EBHSV)

Conserved terminal sequences of genomic RNAs

5' ends

Norovirus. Genogroup I (NV, BoCV), II (PoCV) viruses.
[Vesivirus (PCV) and Lagovirus (RHDV) included for comparison].

         5' end
NV       GUGAAUGAUGAUGGCGUCGAAAGACGUCGUUGCAACUAACGCUUC...  AF093797   AF093797
BoCV     --------A--CUUU-A---U-UGGA-UC--C----GUUAAAG-U...  BCA011099  AJ011099
PoCV     ----UC- -------UAAU UGCCGUC------CUA-UGG--AGU...  AF182760   AF182760

PCV      --A----- --AUUU-A -CU-UGGC--AAACGCU--C-AAAA--...  AF091736   AF091736
RHDV     -----A- -U------G-U-UGUCGCG-C--A-UGGC-UGA--A-...  RHVCG      M67473

Vesiviruses.
[Genogroup I (NV, BoCV), II (PoCV) and Lagovirus (RHDV) are included for comparison].

         5' end
FCV      GUAAAAGA  AAUUUGAGACAAUGUCUCAAACUCUGAGCUUCGUG...  CVXCOMGEN  M86379
FCV-F4   --------  -----------------------------------...  FCLF4      D31836
FCV-F65  --------  -----------------------------------...  AF109465   AF109465
FCV-CFI  --------  -----------------------------------...  FCU13992   U13992
PCV      -----U-- G------- G-U---G-------G--CUCAAAAA-C...  AF091736   AF091736

NV       --G--U--UG-UGGC-UCGA--GACG--GUUGCAACUAACG-U-C     AF093797   AF093797
BoCV     --G--U--AG-C-----CGAU---GA-UCUU-CAACGUUAAA--U...  BCA011099  AJ011099
PoCV     --G-UC-UGAUGGC-A-UUGCCGUC-GUUGC--A-UG-GCAGU--...  AF182760   AF182760
RHDV     --G----UUAUGGCG-C   U-----G-GCCUUACUG--A-GACU...  RHVCG      M67473

3' ends

Vesiviruses. The FCV's are clearly very closely related among themselves. The PCV (Pan-1), SMSV and VESV are also closely related among themselves. However, there is poor resemblance between the two groups. Note that the similarity of PCV to the FCV group is much lower than to the second group. NV has limited resemblance to either groups.

                                                                 3' end
FCV        UGUUUAAAAUUUGAUCAUAUAUCCC  UUUGGGCUGCCGCACCUGCGCCUAACCCCAGGG  CVXCOMGEN  M86379
FCV-F4     ---------A--------G------  --------------UU----U------------  FCLF4      D31836
FCV-F65    -------G-A--------G------  --C-----------AUA----------------  AF109465   AF109465
FCV-CFI    ----C--G-A-------CU--A---  ------ --------U-----------------  FCU13992   U13992
FCV-lS012  ----------C-------G-----   --C-- ---U-----A-----------------  AF109467   AF109467
FCV-JOK63  -------G-----------CG-AU-CC-----C- -U---- U-UAA-------------  AF109466   AF109466

                                                                 3' end
PCV        GGGAUAAUUGUUCUUAAUCUAGUAGACUGUAGAAUUAGCUAAUUGGUAGGUUGCAUUAGG  AF091736    AF091736
SMSV-1     ----------G-----G-A-UU----------U--AGUU-GG-------A----------  SMS1POLCAP  M87481
SMSV-4     ----------G---------------------------U---------------------  SMS4POLCAP  M87482
SVEV       --------------------------------------U---------------------  VEU76874    U76874

NV         GUUUCU--G--GUC-UUAA--CAGAUAGA-UACCCCUUU-CGCAAA----AG-U-GGGAA  AF093797    AF093797

Lagoviruses. There is no resemblance between the Lagoviruses and the other Caliciviruses.

                                                                3' end
RHDV      AUUUGAUUUUAUUGGUUUUAAAAUUUGGUUUAAUUGGGUUUAUAGUUUAAAGUAAGCUAU  RHVCG      M67473
EBHSV-GD  ----A-A---GAGUU-AA-U-G---A-U-G-UUAGU-A--------------C--AU---  EBHSVVP60  Z32526