Benyvirus

Single-stranded, Positive sense, segmented RNA genome: 4 to 5 segments

Sequences shown here are the genomic positive-strand RNA

Benyvirus

e.g., Beet necrotic yellow vein virus (BNYVV), Beet soil-borne mosaic virus (BSBMV)

RNA3, and RNA4 of BNYVV are not required for virus infection of lab hosts, but are always present in field isolates. RNA3 is associated with rhizomania and systemic movement in beets and spinach [Lauber et al. 1998], and RNA4 is associated with efficiency of transmission by the fungal vector (Polymyxa betae). RNA5 is found only in some isolates, and appears to be associated with severe symptoms.

Sequences from: Saito, et al., 1996; Kiguchi, et al., 1996; and Lee, et al., 2001.

Conserved terminal sequences of genomic RNAs

Short conserved sequence at the 5' end, and very long conserved sequence at the 3' end.

5' end

    	    :    |    :    |    :    |    :    |    :    |    :    |
BNYVV_RNA1	AAAUUCGAUUCUUCCCAUUCGCCAUCAUUGAA  UCAUUACUCGUGUACUGGAACGCAGUU...    NC_003514
BSBMV_RNA1	------     ---------------------  --G---U----A---------------...    NC_003506
BNYVV_RNA2	------U-ACUA-UAUC-C-AUUGAAUAGA-UU ---CCGUCU--UGGU-CUU-UUUU---...    NC_003515
BSBMV_RNA2	GG----U-A-UA-UAUC-C-AUUGAAUA ---UU---CC-ACUA-UGU---AU-UCUU--C...    NC_003503
BNYVV_RNA3	------A-AAU--A-----ACAU--UGG-AUUU  AU----C-UCAGUUG-UG-UAU-UG-...    NC_003516
BSBMV_RNA3	-----UA-A--- AU--CCACAU -AGG-AUUA  AU---U----C-CUA-AC--UUUUG-...    NC_003507
BNYVV_RNA4	------A-A---CAAA- -AUA  -UUG-AUUU  -CAGUUGAU---CUGUA--ACA-U-C...    NC_003517
BSBMV_RNA4	------A-AA--CAAA-A-AUAAU-UUG-AUUU  -CAGUUGAU-A-CUGUA--AUA-UC-...    NC_003508
BNYVV_RNA5	     UAC--A--AGU-CCGCUGU--UAA-UGACGU-AGUGGG-----GGCCCGG-G--C-...    NC_003513

3' end

          	      -60                 -40                 -20                  
          	  :    |    :    |    :    |    :    |    :    |    :    |    :    
BNYVV RNA1	...UAAUGUACUGACUGGGUGUGAAUUGUACCAGUCGUUAAAGGGUUUACUAUCAGUAUAUUGAUAU
BSBMV RNA1	...---------------------------------C--GU-------G--------G---------
BNYVV RNA2	...C-G------------------------------CA-GU-----C-GU-U-----------    
BSBMV RNA2	...------------C----------------G---C--GU--------U-U-----U-----    
BNYVV RNA3	...AG--------------------A----------C--GU------CUU-G------------C  
BSBMV RNA3	...--U-------------------A----------C--GU-----G---CU------------AG 
BNYVV RNA4	...AG--------------------A----------U---U------CU--G------------C  
BSBMV RNA4	...--U-------------------A----------C--GU-----G--U-U-----U-----    
BNYVV RNA5	...GG-------------A------A---G------U---U------CU--G-----G------C  


References

Those that are not available through PubMed of the National Library of Medicine, USA.