Arenaviridae

Single-stranded, ambisense, segmented RNA genome: large (L) and small (S) segments

Sequences shown here are those of the genomic minus-strand RNA

Arenavirus

1. LCMV-LASV complex, or "Old World" arenavirus

e.g., lymphocytic choriomeningitis virus (LCM), Lassa (LAS), Mopeia virus

2. Tacaribe complex, or "New World" arenavirus

e.g., Junin (JUN), Machupo, Tacaribe (TAC), Pichinde (PIC) viruses

Conserved terminal sequences of genomic RNAs

See: Auperin, et al., 1982; Auperin and McCormick, 1989

The minimal LCMV genomic promoter includes the 3' terminal 19 nt (Perez and de la Torre [2003])

L segment:

       5' end              Viral RNA           3' end
           5   10   15   20          15   10    5
           :    |    :    |           :    |    :    
LCM    CGCACCGGGGAUCCUAGGCGAU.....GCCUAGGAUCCUCGGUGCG   AF004519 AF004519
LAS    -------------------AA-.....-------------------   LVU73034 U73034
TAC    ----------------------.....-----------A-U-----   TACLSEG  J04340
PIC                            ...-------------------   PICLRNAA J02277

S segment:

       5' end              Viral RNA           3' end
           5   10   15   20          15   10    5
           :    |    :    |           :    |    :    
LCM    -------------------U--.....-----------A-U-----   LCVGPNP  M20869
LAS   G-------------------A--.....-----------A-U-----   LSVNGPC  J04324
PIC    -------------------A-A.....-----------A-U-----   PICSRNA  K02734
JUN  UG-AGUAA-------------G--.....-----------A-U-----   JUNSRNA  D10072
TAC                             ..-----------A-U-----   TACNP    M20304

5' and 3' ends are invert repeats that can potentially form panhandle structures

e.g., LCM S segment

           5   10   15   20
           :    |    :    |    
LCM    CGCACCGGGGAUCCUAGGCUUUUUGGAUUGCGCUUUCCUCUAGAUCAACU_____
       ||||| | ||||||||||| ||| :   :||: ||  ||  |||     |     )
       GCGUGUCACCUAGGAUCCGUAAACUAACGCGUAAACAGAACUCUUUGGUA-----

Conserved stem-loop structure in the intergenic region

Probably involved in termination of ambisense mRNA transcription.